Stem-loop sequence bra-MIR5718

AccessionMI0019330 (change log)
DescriptionBrassica rapa miR5718 stem-loop
Literature search

5 open access papers mention bra-MIR5718
(7 sentences)

Stem-loop
   uga              a          -     a             ag     c          au      c                 u   aa       --       uug 
5'    uuuauguuuuguug ucuuguucug guuug uuuugaacagcuu  uguug ucuguaaugg  gcauaa caguagauaugucagga auu  aaggaac  cguuauu   c
      |||||||||||||| |||||||||| ||||| |||||||||||||  ||||| ||||||||||  |||||| ||||||||||||||||| |||  |||||||  |||||||   c
3'    aaauacaaggcgac agaacaagac caaac aagacuugucgaa  acgac agacauuacc  cguauu gucaucuauacagucuu uaa  uuccuug  gcgauag   u
   cua              a          a     c             ca     a          ac      c                 c   gc       ua       ugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 4446439-4446672 [+]
intergenic
Database links

Mature sequence bra-miR5718

Accession MIMAT0023016
Sequence

194 - 

ucagaaccaaacacagaacaag

 - 215

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).
2