Stem-loop sequence bra-MIR5717

AccessionMI0019328 (change log)
DescriptionBrassica rapa miR5717 stem-loop
Literature search

1 open access papers mention bra-MIR5717
(1 sentences)

Stem-loop
   ucucucuc   c    u                             uucauucaccauc 
5'         ucu ucua gauccccaguuuggauuguuugccuuggc             u
           ||| |||| |||||||||||||||||||||||||||||             u
3'         aga agau cuaggggucaaaccuaacaaacggaaccg             c
   --------   -    u                             uccauugcaauca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 17555972-17556083 [+]
intergenic
Database links

Mature sequence bra-miR5717

Accession MIMAT0023014
Sequence

26 - 

guuuggauuguuugccuuggc

 - 46

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).