Stem-loop sequence bra-MIR5716

AccessionMI0019327 (change log)
DescriptionBrassica rapa miR5716 stem-loop
Literature search

3 open access papers mention bra-MIR5716
(3 sentences)

Stem-loop
   ------                     -cga     a     c    -uuc   u                      ca         a           cucu  g 
5'       gauccagacgugaccaaccau    cuucu guucc uucu    cuu ucauuuauuguuuauaucuuca  uaucuaaag guuucuucagu    au a
         |||||||||||||||||||||    ||||| ||||| ||||    ||| ||||||||||||||||||||||  ||||||||| |||||||||||    ||  
3'       cuaggucugcacugguuggua    gaaga caagg aagg    gaa aguaaguaacaaauauagaagu  auagguuuc uaaagaaguca    ua a
   cuuuuu                     aaca     c     a    uaaa   c                      ua         a           --uu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 26758337-26758542 [+]
intergenic
Database links

Mature sequence bra-miR5716

Accession MIMAT0023013
Sequence

121 - 

uuggauaauugaagauauaaa

 - 141

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).