Stem-loop sequence bra-MIR5714

AccessionMI0019325 (change log)
DescriptionBrassica rapa miR5714 stem-loop
Literature search

2 open access papers mention bra-MIR5714
(2 sentences)

Stem-loop
   --   au       aug    uca    u ---au  -        gauuuc          g    c                 g  aac    u    -------cug      gauau    a 
5'   ggu  gagcuuu   ugau   gugg g     uc ucgagaau      aacuguuucu gaug uguagagucuugucauc ag   uugc ggcu          uuucug     ucaa c
     |||  |||||||   ||||   |||| |     || ||||||||      |||||||||| |||| ||||||||||||||||| ||   |||| ||||          ||||||     ||||  
3'   ccg  cuuggaa   acua   cauc c     ag agcucuua      uugacaaaga cuac gcaucucagaacaguag uc   aacg ucga          aaagau     gguu u
   aa   gu       aca    caa    u agaac  u        ---aaa          a    a                 a  cua    u    aaucguacaa      --agu    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA6: 4279161-4279396 [-]
intergenic
Database links

Mature sequence bra-miR5714

Accession MIMAT0023011
Sequence

162 - 

agacucuacgacaucaagaaac

 - 183

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).