Stem-loop sequence bra-MIR5713

AccessionMI0019324 (change log)
DescriptionBrassica rapa miR5713 stem-loop
Literature search

1 open access papers mention bra-MIR5713
(1 sentences)

Stem-loop
   auaa                c   u                                                                            ugcagaccaguuaugacugugauacccagucacagcggaaggguucuuaaggauucauaacuguuuugucaaggguucagaauguuuuuuuggggaaaugauaggguuuacaauggcaaaauu 
5'     gcagaguuacucuagg aau aucuuccuccgauugaaauuugcagaccaguuggacuaccggagcuagguaggcuuagaagaacguuuguuaaauu                                                                                                                           a
       |||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                                                                                                                            
3'     ugucucaaugagaucc uua uagaaggaggcuaacuuuaaacgucuggucaaccugauggccucgauccauccgaaucuucuugcaaacaauuuaa                                                                                                                           g
   ----                a   c                                                                            cuacccagucagcucagacucgcccgguggcaaugguugacuacguuugucaccuuucucugccaaacaccuaaugaacuugucucucaaaucuccauuauugcgaacuuacguaguagagag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA9: 34116461-34116906 [+]
intergenic
Database links

Mature sequence bra-miR5713

Accession MIMAT0023010
Sequence

76 - 

aggcuuagaagaacguuuguu

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).