Stem-loop sequence bra-MIR5712

AccessionMI0019323 (change log)
DescriptionBrassica rapa miR5712 stem-loop
Literature search

2 open access papers mention bra-MIR5712
(2 sentences)

Stem-loop
   guu     uaa                            aa          u    aaaacuuaagagaguua 
5'    cacau   gaaucucucaucaauuauauuaguauuu  auagaaaguu cuca                 u
      |||||   ||||||||||||||||||||||||||||  |||||||||| ||||                  
3'    gugua   cuuagagagugguuaauauaauuauaaa  uaucuuuuaa gagu                 g
   --g     ---                            ac          -    cauuuuuagauaggagc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Brapa_1.1; GCA_000309985.1) Overlapping transcripts
chrA1: 6456454-6456595 [+]
intergenic
Database links

Mature sequence bra-miR5712

Accession MIMAT0023009
Sequence

110 - 

aauauuaauauaauuggugag

 - 130

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).