Stem-loop sequence bra-MIR5654b

AccessionMI0019322 (change log)
DescriptionBrassica rapa miR5654b stem-loop
Gene family MIPF0001454; MIR5654
Literature search

2 open access papers mention bra-MIR5654b
(2 sentences)

Stem-loop
   uaa   -ug     -   cu   cguuucu  uuc  -u          --uc   uauua                          cc    u    c  ga 
5'    uga   uauug uag  cug       ug   gu  cacucuuuug    agg     acaagauaaaucccaagcaucaucca  uuau agcc uu  a
      |||   ||||| |||  |||       ||   ||  ||||||||||    |||     ||||||||||||||||||||||||||  |||| |||| ||   
3'    acu   guaac auc  gau       ac   cg  gugagaaaau    ucc     uguuuuauuuaggguucguaguaggu  aaug ucgg ag  c
   -ag   uua     c   ag   -------  cuc  uu          cuuc   ucuca                          aa    u    a  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bra-miR5654b

Accession MIMAT0023008
Sequence

62 - 

auaaaucccaagcaucaucca

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22025521 "Identification of conserved and novel microRNAs that are responsive to heat stress in Brassica rapa" Yu X, Wang H, Lu Y, de Ruiter M, Cariaso M, Prins M, van Tunen A, He Y J Exp Bot. 63:1025-1038(2012).