Stem-loop sequence mmu-mir-5710

AccessionMI0019319 (change log)
Symbol MGI:Mir5710
DescriptionMus musculus miR-5710 stem-loop
Stem-loop
   aga   uu      u  u  a  gc     -u  g 
5'    guc  gggaca ag gu ag  agugg  cu g
      |||  |||||| || || ||  |||||  ||  
3'    cgg  cccugu uc cg uc  ucacc  ga c
   --a   cu      u  u  g  aa     cu  u 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 13 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr9: 54708313-54708381 [+]
sense
OTTMUST00000067744 ; Dnaja4-001; intron 2
OTTMUST00000067745 ; Dnaja4-002; intron 3
OTTMUST00000067746 ; Dnaja4-003; intron 3
ENSMUST00000070070 ; Dnaja4-001; intron 2
ENSMUST00000120452 ; Dnaja4-002; intron 3
ENSMUST00000154690 ; Dnaja4-003; intron 3
Database links

Mature sequence mmu-miR-5710

Accession MIMAT0022505
Sequence

5 - 

ucuugggacauaguguaaggca

 - 26

Get sequence
Deep sequencing43 reads, 12 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21984899 "Neuronal activity regulates hippocampal miRNA expression" Eacker SM, Keuss MJ, Berezikov E, Dawson VL, Dawson TM PLoS One. 6:e25068(2011).