Stem-loop sequence mmu-mir-344i

AccessionMI0019317 (change log)
Symbol MGI:Mir344i
DescriptionMus musculus miR-344i stem-loop
Gene family MIPF0000267; mir-344
Stem-loop
   ----   -   u  ca        u            ------     u 
5'     ggg auu ug  agucaggc ccuggcuggagu      ccagc c
       ||| ||| ||  |||||||| ||||||||||||      ||||| u
3'     cuc uag ac  ucagucug ggaccgaucucg      ggucg c
   auga   g   u  -a        -            gaccug     a 
Get sequence
Deep sequencing
219 reads, 0 reads per million, 18 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 62085223-62085310 [-]
intergenic
Database links

Mature sequence mmu-miR-344i

Accession MIMAT0022503
Sequence

11 - 

aagucaggcuccuggcugga

 - 30

Get sequence
Deep sequencing203 reads, 17 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21984899 "Neuronal activity regulates hippocampal miRNA expression" Eacker SM, Keuss MJ, Berezikov E, Dawson VL, Dawson TM PLoS One. 6:e25068(2011).