Stem-loop sequence hsa-mir-5692a-2

AccessionMI0019298 (change log)
Symbol HGNC:MIR5692A2
DescriptionHomo sapiens miR-5692a-2 stem-loop
Gene family MIPF0001351; mir-5692
Stem-loop
              c    gu        - uc 
5' uacaaauaaua caca  ggguguac c  a
   ||||||||||| ||||  |||||||| |   
3' auguuuauuau gugu  cccacaug g  u
              a    --        u ug 
Get sequence
Deep sequencing
140 reads, 0 reads per million, 41 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 12719132-12719190 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-5692a-2
hsa-mir-5692a-2chr8: 12719132-12719190 [+]
hsa-mir-3926-1chr8: 12727232-12727304 [-]
hsa-mir-3926-2chr8: 12727237-12727299 [+]
Database links

Mature sequence hsa-miR-5692a

Accession MIMAT0022484
Sequence

3 - 

caaauaauaccacagugggugu

 - 24

Get sequence
Deep sequencing275 reads, 42 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).