Stem-loop sequence gma-MIR5673

AccessionMI0019268 (change log)
DescriptionGlycine max miR5673 stem-loop
Stem-loop
   aauc      c                      acaacuacggaagacagcu 
5'     uucuuc guggaaucucgcggaagacauu                   u
       |||||| ||||||||||||||||||||||                   c
3'     aagaag caccuuagagugccuucuguaa                   u
   uuau      a                      aaggcacucgaaggugccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr1: 39450461-39450567 [+]
intergenic
Clustered miRNAs
< 10kb from gma-MIR5673
gma-MIR5673chr1: 39450461-39450567 [+]
gma-MIR4380achr1: 39453514-39453666 [-]
Database links

Mature sequence gma-miR5673

Accession MIMAT0022456
Sequence

11 - 

cguggaaucucgcggaagacau

 - 32

Get sequence
Evidence experimental; Illumina [1], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).