Stem-loop sequence gma-MIR5671a

AccessionMI0019265 (change log)
Previous IDsgma-MIR5671
DescriptionGlycine max miR5671 stem-loop
Gene family MIPF0002004; MIR5671
Literature search

1 open access papers mention gma-MIR5671a
(1 sentences)

Stem-loop
   -                  ug   -    u     uuccaug   aucucuccu   c     c 
5'  auugauucaucauggaag  aau cggg gacuc       uug         cca caccu c
    ||||||||||||||||||  ||| |||| |||||       |||         ||| ||||| u
3'  uaacuaagugguaccuuc  uua gccc uugag       aac         ggu gugga u
   c                  gu   a    u     -ucuuua   ---------   a     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 27953059-27953177 [-]
intergenic
Database links

Mature sequence gma-miR5671a

Accession MIMAT0022453
Previous IDsgma-miR5671
Sequence

11 - 

cauggaagugaaucgggugac

 - 31

Get sequence
Evidence experimental; Illumina [1-2], RT-PCR [1]

References

1
PMID:21219599 "Identification of miRNAs and their target genes in developing soybean seeds by deep sequencing" Song QX, Liu YF, Hu XY, Zhang WK, Ma B, Chen SY, Zhang JS BMC Plant Biol. 11:5(2011).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).