Stem-loop sequence meu-mir-16c

AccessionMI0019260 (change log)
DescriptionMacropus eugenii miR-16c stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   ------aa    -g   g   c u       c u   a       ---    c 
5'         gcuc  gcu ugc c agcagca g caa acuggag   uuaa u
           ||||  ||| ||| | ||||||| | ||| |||||||   ||||  
3'         cgag  ugg gcg g ucgucgu c guu ugaccuc   aauu g
   acuugguc    ga   a   a u       u c   a       cua    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence meu-miR-16c

Accession MIMAT0022448
Sequence

17 - 

uagcagcacgucaaaacuggag

 - 38

Get sequence
Evidence not experimental

References

1