Stem-loop sequence ath-MIR5654

AccessionMI0019237 (change log)
DescriptionArabidopsis thaliana miR5654 stem-loop
Literature search

1 open access papers mention ath-MIR5654
(3 sentences)

Stem-loop
                --         cc   c    cu gaa 
5' aaauaaaucccaa  caucuucca  uua cggc  u   c
   |||||||||||||  |||||||||  ||| ||||  |    
3' uuuauuuaggguu  guagaaggu  aau gucg  a   a
                uc         aa   u    au guu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 11786292-11786371 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR5654
ath-MIR400chr1: 11785936-11786037 [+]
ath-MIR5654chr1: 11786292-11786371 [+]
Database links

Mature sequence ath-miR5654-5p

Accession MIMAT0022426
Previous IDsath-miR5654
Sequence

3 - 

auaaaucccaacaucuucca

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ath-miR5654-3p

Accession MIMAT0023005
Sequence

57 - 

uggaagaugcuuugggauuuauu

 - 79

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).
2