Stem-loop sequence ath-MIR156j

AccessionMI0019234
DescriptionArabidopsis thaliana miR156j stem-loop
Stem-loop
   uuu    -g   ag       -    uuu    c 
5'    gaca  aag  agagagc acag   gagu g
      ||||  |||  ||||||| ||||   |||| c
3'    cugu  uuu  ucucucg uguu   cuua c
   uac    ga   ga       a    -cc    a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10) Overlapping transcripts
chr2: 17589020-17589087 [-]
intergenic

Mature sequence ath-miR156j

Accession MIMAT0022423
Sequence

3 - 

ugacagaagagagagagcac

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).