Stem-loop sequence ath-MIR156i

AccessionMI0019232
DescriptionArabidopsis thaliana miR156i stem-loop
Stem-loop
   --------------------------uagaugacagaagagagagagcaga   cu  ucuaucu    u       cu  aa     -  uuugg  u      u    ucuc 
5'                                                    cag  uc       aauc guggucg  ug  ugaug ag     ca aggaag guca    u
                                                      |||  ||       |||| |||||||  ||  ||||| ||     || |||||| ||||     
3'                                                    guc  ag       uuag uaccagu  ac  acuac uc     gu ucuuuc uagu    a
   uguuacucgcuucuuccuucucgagaccacucucaugaauaccucuuccua   -c  ccucucc    u       cc  -c     g  --uua  -      -    uccc 
Get sequence
Deep sequencing
1 reads, 0.722 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10) Overlapping transcripts
chr1: 19806917-19807113 [-]
intergenic

Mature sequence ath-miR156i

Accession MIMAT0022421
Sequence

5 - 

ugacagaagagagagagcag

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).