Stem-loop sequence ath-MIR781b

AccessionMI0019231 (change log)
DescriptionArabidopsis thaliana miR781b stem-loop
Gene family MIPF0001137; MIR781
Literature search

2 open access papers mention ath-MIR781b
(2 sentences)

Stem-loop
   au                     aa     auau      ag 
5'   uuagaguuuucuggauacuua  aguua    cgaaga  c
     |||||||||||||||||||||  |||||    ||||||  c
3'   aaucucaaaagaccuaugaau  ucaau    guuucu  c
   uu                     aa     gauu      cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 7423521-7423607 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR781b
ath-MIR781bchr1: 7423521-7423607 [-]
ath-MIR781achr1: 7423518-7423611 [+]
Database links

Mature sequence ath-miR781b

Accession MIMAT0022420
Sequence

3 - 

uuagaguuuucuggauacuua

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).