Stem-loop sequence ath-MIR833b

AccessionMI0019230 (change log)
DescriptionArabidopsis thaliana miR833b stem-loop
Literature search

2 open access papers mention ath-MIR833b
(3 sentences)

Stem-loop
   c          -  a         c        uac      g 
5'  uuguuuguug ac ucggucuag ucaaacca   auauuu c
    |||||||||| || ||||||||| ||||||||   ||||||  
3'  aacaaacaac ug agccagauc aguuuggu   uguaga a
   a          a  -         a        -uu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 29525202-29525286 [-]
intergenic
Clustered miRNAs
< 10kb from ath-MIR833b
ath-MIR833bchr1: 29525202-29525286 [-]
ath-MIR833achr1: 29525151-29525337 [+]
Database links

Mature sequence ath-miR833b

Accession MIMAT0022419
Sequence

3 - 

uguuuguugacaucggucuag

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).