Stem-loop sequence ath-MIR858b

AccessionMI0019228 (change log)
DescriptionArabidopsis thaliana miR858b stem-loop
Gene family MIPF0001138; MIR858
Literature search

4 open access papers mention ath-MIR858b
(7 sentences)

Stem-loop
   ccuac    ag    uu  -a          -a    caaacauagaggugugaguuugguuugguuuuggguuuugggggguugguaguguuugagguccauaugccucgaucuuccgcuucuauuaauuaauuuucucuauuagaaauauua 
5'      ccga  gguu  gg  gaguagacaa  gaga                                                                                                                     u
        ||||  ||||  ||  ||||||||||  ||||                                                                                                                     c
3'      gguu  ucgg  cc  cuugucuguu  uucu                                                                                                                     u
   ----c    --    uu  ag          gc    auucuaccuuggucuagcccugacgaggaaacuguucacaaacgugacuuaaguuuuugaaacuacccgaauauguauaguaauauauacacguaccaagcuaccucaccuuauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (TAIR10; GCA_000001735.1) Overlapping transcripts
chr1: 26772633-26772935 [+]
intergenic
Clustered miRNAs
< 10kb from ath-MIR858b
ath-MIR858bchr1: 26772633-26772935 [+]
ath-MIR858achr1: 26773539-26773725 [-]
Database links

Mature sequence ath-miR858b

Accession MIMAT0022417
Sequence

275 - 

uucguugucuguucgaccuug

 - 295

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21940835 "High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis" Breakfield NW, Corcoran DL, Petricka JJ, Shen J, Sae-Seaw J, Rubio-Somoza I, Weigel D, Ohler U, Benfey PN Genome Res. 22:163-176(2012).