|
miRBase |
|
Stem-loop sequence ath-MIR5636 |
|||||
| Accession | MI0019208 | ||||
| Description | Arabidopsis thaliana miR5636 stem-loop | ||||
| Stem-loop |
gu u a gcgc guuu uc agauc agu gc gagcuugacg ucau ac u ||||| ||| || |||||||||| |||| || u uuugg ucg cg uucggacugc agua ug u au c a ---- -aau uu |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence ath-miR5636 |
|
| Accession | MIMAT0022396 |
| Sequence |
5 - cguaguugcagagcuugacgg - 25 |
| Deep sequencing | 2 reads, 2 experiments |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:21940835
"High-resolution experimental and computational profiling of tissue-specific known and novel miRNAs in Arabidopsis"
Genome Res. 22:163-176(2012).
|