Stem-loop sequence mmu-mir-5627

AccessionMI0019198 (change log)
Symbol MGI:Mir5627
DescriptionMus musculus miR-5627 stem-loop
Literature search

1 open access papers mention mmu-mir-5627
(2 sentences)

Stem-loop
   -a     u       ---     gc    c gc 
5'   gaggg gcgccgg   gcccu  gucc c  c
     ||||| |||||||   |||||  |||| |   
3'   cuccc cgcggcc   cggga  cagg g  c
   ug     -       ucu     --    a au 
Get sequence
Deep sequencing
76 reads, 7.14 reads per million, 42 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 44210313-44210373 [+]
intergenic
Database links

Mature sequence mmu-miR-5627-5p

Accession MIMAT0022385
Sequence

1 - 

agagggugcgccgggcccugcg

 - 22

Get sequence
Deep sequencing20 reads, 17 experiments
Evidence not experimental
Predicted targets

Mature sequence mmu-miR-5627-3p

Accession MIMAT0022386
Sequence

38 - 

acagggcucuccggcgccccucgu

 - 61

Get sequence
Deep sequencing55 reads, 33 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).