Stem-loop sequence mmu-mir-344h-2

AccessionMI0019197 (change log)
Symbol MGI:Mir344h-2
DescriptionMus musculus miR-344h-2 stem-loop
Gene family MIPF0000267; mir-344
Literature search

9 open access papers mention mmu-mir-344h-2
(34 sentences)

Stem-loop
   -----ca     c   c     u       au 
5'        ggcuu ugg uauau ccaggac  a
          ||||| ||| ||||| |||||||  c
3'        ccgaa acc auaug gguccug  c
   ugucagc     -   a     -       gu 
Get sequence
Deep sequencing
48 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 61742366-61742425 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-344h-2
mmu-mir-344h-2chr7: 61742366-61742425 [-]
mmu-mir-344h-1chr7: 61739350-61739409 [-]
mmu-mir-344echr7: 61735537-61735602 [-]
Database links

Mature sequence mmu-miR-344h-5p

Accession MIMAT0022383
Sequence

1 - 

caggcuucuggcuauauucc

 - 20

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence not experimental
Predicted targets

Mature sequence mmu-miR-344h-3p

Accession MIMAT0022384
Sequence

39 - 

gguauaaccaaagcccgacugu

 - 60

Get sequence
Deep sequencing88 reads, 11 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).