Stem-loop sequence mmu-mir-5623

AccessionMI0019191 (change log)
Symbol MGI:Mir5623
DescriptionMus musculus miR-5623 stem-loop
Stem-loop
   --          c          g    ug ga  g 
5'   uggcagcugg aagucagaau cagg  u  au g
     |||||||||| |||||||||| ||||  |  ||  
3'   acugucgacu uucggucuug gucu  g  ua a
   cc          -          -    gg gg  c 
Get sequence
Deep sequencing
56 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 58051167-58051236 [+]
sense
ENSMUST00000077282 ; Atrnl1-201; intron 28
Database links

Mature sequence mmu-miR-5623-5p

Accession MIMAT0022373
Sequence

1 - 

uggcagcuggcaagucagaaugca

 - 24

Get sequence
Deep sequencing39 reads, 24 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence mmu-miR-5623-3p

Accession MIMAT0022374
Sequence

49 - 

guucuggcuuucagcugucacc

 - 70

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).