Stem-loop sequence mmu-mir-299b

AccessionMI0019180 (change log)
Symbol MGI:Mir299b
DescriptionMus musculus miR-299b stem-loop
Gene family MIPF0000186; mir-299
Literature search

25 open access papers mention mmu-mir-299b
(91 sentences)

Stem-loop
                        ac 
5' gguuuaccgucccacauacau  u
   |||||||||||||||||||||  c
3' ccaaauggcaggguguaugua  a
                        aa 
Get sequence
Deep sequencing
5543 reads, 58.3 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109710645-109710693 [-]
sense
ENSMUST00000175550 ; Gm25400-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-299b
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-758chr12: 109712810-109712890 [+]
mmu-mir-323chr12: 109712508-109712593 [+]
mmu-mir-1197chr12: 109712317-109712436 [+]
mmu-mir-380chr12: 109711803-109711863 [+]
mmu-mir-299bchr12: 109710645-109710693 [-]
mmu-mir-299achr12: 109710638-109710700 [+]
mmu-mir-411chr12: 109710175-109710256 [+]
mmu-mir-379chr12: 109709060-109709125 [+]
Database links

Mature sequence mmu-miR-299b-5p

Accession MIMAT0022836
Sequence

1 - 

gguuuaccgucccacauacau

 - 21

Get sequence
Deep sequencing89 reads, 24 experiments
Evidence not experimental
Predicted targets

Mature sequence mmu-miR-299b-3p

Accession MIMAT0022837
Sequence

32 - 

uaugugggacgguaaacc

 - 49

Get sequence
Deep sequencing5453 reads, 69 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).