Stem-loop sequence mmu-mir-3544

AccessionMI0019179 (change log)
Symbol MGI:Mir3544
DescriptionMus musculus miR-3544 stem-loop
Gene family MIPF0001349; mir-3544
Literature search

1 open access papers mention mmu-mir-3544
(1 sentences)

Stem-loop
   -a   a   a    a      c   a  gc 
5'   gaa ggc ucau uaggag uga ug  u
     ||| ||| |||| |||||| ||| ||   
3'   cuu ccg agua guccuc acu ac  g
   cc   g   c    c      a   a  gu 
Get sequence
Deep sequencing
79 reads, 0 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109585813-109585873 [-]
antisense
ENSMUST00000083592 ; Mir337-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-3544
mmu-mir-136chr12: 109595327-109595388 [+]
mmu-mir-3071chr12: 109595318-109595397 [-]
mmu-mir-432chr12: 109594956-109595030 [+]
mmu-mir-434chr12: 109594506-109594599 [+]
mmu-mir-127chr12: 109592846-109592915 [+]
mmu-mir-433chr12: 109591715-109591838 [+]
mmu-mir-431chr12: 109590447-109590537 [+]
mmu-mir-3070-2chr12: 109588592-109588680 [+]
mmu-mir-3070-1chr12: 109587943-109588031 [+]
mmu-mir-665chr12: 109586314-109586407 [+]
mmu-mir-540chr12: 109586080-109586146 [+]
mmu-mir-3544chr12: 109585813-109585873 [-]
mmu-mir-337chr12: 109585789-109585885 [+]
mmu-mir-493chr12: 109580233-109580315 [+]
Database links

Mature sequence mmu-miR-3544-5p

Accession MIMAT0022353
Sequence

1 - 

agaaaggcaucauauaggagcug

 - 23

Get sequence
Deep sequencing40 reads, 14 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence mmu-miR-3544-3p

Accession MIMAT0022354
Sequence

40 - 

acuccugcaugacgccguuccc

 - 61

Get sequence
Deep sequencing35 reads, 16 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).