![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence cel-mir-5595 |
|||||
Accession | MI0019159 (change log) | ||||
Description | Caenorhabditis elegans miR-5595 stem-loop | ||||
Stem-loop |
-- u ca aaaa u 5' ucucuuuuuuc cgcaugc ucuc ca c ||||||||||| ||||||| |||| || 3' agagagaagag gugugcg agag gu g gc - ag --cg a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence cel-miR-5595-5p |
|
Accession | MIMAT0022313 |
Sequence |
1 - ucucuuuuuucucgcaugccaucu - 24 |
Deep sequencing | 9 reads, 6 experiments |
Evidence | not experimental |
Mature sequence cel-miR-5595-3p |
|
Accession | MIMAT0022314 |
Sequence |
43 - agagcguguggagaagagagacg - 65 |
Deep sequencing | 47 reads, 12 experiments |
Evidence | not experimental |
Database links |
|
References |
|
1 |
PMID:21911355
"miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades"
Nucleic Acids Res. 40:37-52(2012).
|