Stem-loop sequence cel-mir-356b

AccessionMI0019158 (change log)
DescriptionCaenorhabditis elegans miR-356b stem-loop
Literature search

2 open access papers mention cel-mir-356b
(3 sentences)

Stem-loop
   --    -   ac   u  u        cg ugaaa 
5'   uggu gag  acg cg aacgaauc  c     u
     |||| |||  ||| || ||||||||  |     u
3'   acca cuc  ugc gc uuguuuag  g     u
   ac    a   gu   -  -        ua uuaca 
Get sequence
Deep sequencing
276 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrIII: 7860167-7860234 [-]
intergenic
Clustered miRNAs
< 10kb from cel-mir-356b
cel-mir-356bchrIII: 7860167-7860234 [-]
cel-mir-356achrIII: 7860147-7860256 [+]
Database links

Mature sequence cel-miR-356b-5p

Accession MIMAT0022311
Sequence

1 - 

uggugagacacgucguaacgaau

 - 23

Get sequence
Deep sequencing76 reads, 12 experiments
Evidence not experimental
Database links

Mature sequence cel-miR-356b-3p

Accession MIMAT0022312
Sequence

46 - 

uuuguucgcguugcucaaccaca

 - 68

Get sequence
Deep sequencing197 reads, 14 experiments
Evidence not experimental
Database links

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).