Stem-loop sequence cel-mir-5594

AccessionMI0019157 (change log)
DescriptionCaenorhabditis elegans miR-5594 stem-loop
Stem-loop
   --               u        cau 
5'   aagaguacuguaguu caaaauuu   u
     ||||||||||||||| ||||||||   g
3'   uucucaugacaucaa guuuuaaa   a
   ac               -        auu 
Get sequence
Deep sequencing
460 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 11865130-11865187 [-]
sense
K12D12.4a ; K12D12.4a; intron 1
K12D12.4b ; K12D12.4b; intron 1
Database links

Mature sequence cel-miR-5594-5p

Accession MIMAT0022309
Sequence

1 - 

aagaguacuguaguuucaaaau

 - 22

Get sequence
Deep sequencing206 reads, 16 experiments
Evidence not experimental
Database links

Mature sequence cel-miR-5594-3p

Accession MIMAT0022310
Sequence

38 - 

uuugaacuacaguacucuuca

 - 58

Get sequence
Deep sequencing249 reads, 12 experiments
Evidence not experimental
Database links

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).