Stem-loop sequence cel-mir-5593-2

AccessionMI0019156 (change log)
DescriptionCaenorhabditis elegans miR-5593-2 stem-loop
Gene family MIPF0001336; mir-5593
Stem-loop
   --ga   c      au       cucg  uga 
5'     ugg uggaau  cgguauu    gc   a
       ||| ||||||  |||||||    ||    
3'     acc accuua  gccauaa    cg   a
   aaca   a      -c       auca  uac 
Get sequence
Deep sequencing
497 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrII: 438399-438461 [+]
sense
C24H12.2 ; C24H12.2; intron 3
Clustered miRNAs
< 10kb from cel-mir-5593-2
cel-mir-5593-1chrII: 431492-431554 [+]
cel-mir-5593-2chrII: 438399-438461 [+]
Database links

Mature sequence cel-miR-5593-5p

Accession MIMAT0022307
Sequence

1 - 

gauggcuggaauaucgguauuc

 - 22

Get sequence
Deep sequencing920 reads, 12 experiments
Evidence not experimental
Database links

Mature sequence cel-miR-5593-3p

Accession MIMAT0022308
Sequence

43 - 

auaccgcauuccaaccaacaa

 - 63

Get sequence
Deep sequencing70 reads, 11 experiments
Evidence not experimental
Database links

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).