Stem-loop sequence cel-mir-5592-1

AccessionMI0019153 (change log)
DescriptionCaenorhabditis elegans miR-5592-1 stem-loop
Gene family MIPF0001366; mir-5592
Stem-loop
   --                       uucc  g 
5'   cggcccuuaccguuuaauacaug    cg u
     |||||||||||||||||||||||    || c
3'   gccgggaauggcaaauuauguac    gu g
   cg                       -cac  a 
Get sequence
Deep sequencing
26074 reads, 159 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WBcel235; GCA_000002985.3) Overlapping transcripts
chrX: 13759245-13759308 [-]
antisense
F55F3.11b ; F55F3.11b; exon 1
F55F3.1.1 ; F55F3.1.1; intron 4
Clustered miRNAs
< 10kb from cel-mir-5592-1
cel-mir-5592-2chrX: 13759247-13759310 [+]
cel-mir-5592-1chrX: 13759245-13759308 [-]
Database links

Mature sequence cel-miR-5592-5p

Accession MIMAT0022305
Sequence

1 - 

cggcccuuaccguuuaauacaug

 - 23

Get sequence
Deep sequencing6218 reads, 14 experiments
Evidence not experimental
Database links

Mature sequence cel-miR-5592-3p

Accession MIMAT0022306
Sequence

42 - 

uguauuaaacgguaagggccggc

 - 64

Get sequence
Deep sequencing38663 reads, 16 experiments
Evidence not experimental
Database links

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).