Stem-loop sequence hsa-mir-548av

Accession MI0019152
Description Homo sapiens miR-548av stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
--       c      a        caccuu 
  aaaagua uugcgg uuugccau      u
  ||||||| |||||| ||||||||       
  uuuucau gacguc aaacggua      a
cg       u      a        auuucc
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr18: 70520556-70520617 [-]
sense
OTTHUMT00000444206 ; NETO1-005; intron 3
OTTHUMT00000256301 ; NETO1-001; intron 4
OTTHUMT00000256302 ; NETO1-002; intron 4
OTTHUMT00000256301 ; NETO1-001; intron 4
OTTHUMT00000256302 ; NETO1-002; intron 4
OTTHUMT00000444204 ; NETO1-003; intron 4
OTTHUMT00000256301 ; NETO1-001; intron 4
OTTHUMT00000256302 ; NETO1-002; intron 4
ENST00000579730 ; NETO1-005; intron 3
ENST00000327305 ; NETO1-001; intron 4
ENST00000397929 ; NETO1-002; intron 4
ENST00000299430 ; NETO1-201; intron 4
ENST00000327305 ; NETO1-001; intron 4
ENST00000397929 ; NETO1-002; intron 4
ENST00000299430 ; NETO1-201; intron 4
ENST00000583169 ; NETO1-003; intron 4
ENST00000327305 ; NETO1-001; intron 4
ENST00000580049 ; NETO1-002; intron 4
ENST00000299430 ; NETO1-201; intron 4
ENST00000397929 ; NETO1-202; intron 4

Mature sequence hsa-miR-548av-5p

Accession MIMAT0022303
Sequence

1 -  

aaaaguacuugcggauuu

 - 18

Get sequence
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-548av-3p

Accession MIMAT0022304
Sequence

43 -  

aaaacugcaguuacuuuugc

 - 62

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).