Stem-loop sequence hsa-mir-548av

AccessionMI0019152 (change log)
Symbol HGNC:MIR548AV
DescriptionHomo sapiens miR-548av stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548av
(170 sentences)

Stem-loop
   --       c      a        caccuu 
5'   aaaagua uugcgg uuugccau      u
     ||||||| |||||| ||||||||       
3'   uuuucau gacguc aaacggua      a
   cg       u      a        auuucc 
Get sequence
Deep sequencing
7853 reads, 25.5 reads per million, 94 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 72853321-72853382 [-]
intergenic
Database links

Mature sequence hsa-miR-548av-5p

Accession MIMAT0022303
Sequence

1 - 

aaaaguacuugcggauuu

 - 18

Get sequence
Deep sequencing5912 reads, 74 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-548av-3p

Accession MIMAT0022304
Sequence

43 - 

aaaacugcaguuacuuuugc

 - 62

Get sequence
Deep sequencing1940 reads, 84 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).