Stem-loop sequence hsa-mir-4536-2

AccessionMI0019149 (change log)
Symbol HGNC:MIR4536-2
DescriptionHomo sapiens miR-4536-2 stem-loop
Gene family MIPF0001319; mir-4536
Stem-loop
                            g    gua   -a   a gu 
5' augugguagauauaugcacgauaua guau   ugu  ugu u  a
   ||||||||||||||||||||||||| ||||   |||  ||| |   
3' uacaccaucuauauacgugcuauau uaug   acg  acg a  u
                            a    ---   gg   a aa 
Get sequence
Deep sequencing
366 reads, 70.6 reads per million, 102 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 55451495-55451582 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-4536-2
hsa-mir-4536-1chrX: 55451495-55451582 [-]
hsa-mir-4536-2chrX: 55451495-55451582 [+]
Database links

Mature sequence hsa-miR-4536-5p

Accession MIMAT0019078
Previous IDshsa-miR-4536
Sequence

2 - 

ugugguagauauaugcacgau

 - 22

Get sequence
Deep sequencing395 reads, 76 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-4536-3p

Accession MIMAT0020959
Sequence

68 - 

ucgugcauauaucuaccacau

 - 88

Get sequence
Deep sequencing148 reads, 39 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).