Stem-loop sequence hsa-mir-5585

Accession MI0019142
Description Homo sapiens miR-5585 stem-loop
Stem-loop 
---  a   a       c  --   ag   a 
   ug agu ccagcua uc  gag  guc g
   || ||| ||||||| ||  |||  |||  
   ac uca ggucgau ag  cuc  uag a
ugg  a   g       a  uc   gu   g
Get sequence
Deep sequencing
25 reads, 8 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 32552550-32552608 [+]
sense
OTTHUMT00000091375 ; TMEM39B-003; intron 3
OTTHUMT00000091379 ; TMEM39B-007; intron 3
OTTHUMT00000091375 ; TMEM39B-003; intron 3
OTTHUMT00000091379 ; TMEM39B-007; intron 3
OTTHUMT00000091375 ; TMEM39B-003; intron 3
OTTHUMT00000091379 ; TMEM39B-007; intron 3
OTTHUMT00000099435 ; TMEM39B-009; intron 4
OTTHUMT00000099435 ; TMEM39B-009; intron 4
OTTHUMT00000099435 ; TMEM39B-009; intron 4
OTTHUMT00000011489 ; TMEM39B-001; intron 5
OTTHUMT00000091374 ; TMEM39B-002; intron 5
OTTHUMT00000091377 ; TMEM39B-005; intron 5
OTTHUMT00000091378 ; TMEM39B-006; intron 5
OTTHUMT00000011489 ; TMEM39B-001; intron 5
OTTHUMT00000091374 ; TMEM39B-002; intron 5
OTTHUMT00000091377 ; TMEM39B-005; intron 5
OTTHUMT00000091378 ; TMEM39B-006; intron 5
OTTHUMT00000011489 ; TMEM39B-001; intron 5
OTTHUMT00000091374 ; TMEM39B-002; intron 5
OTTHUMT00000091377 ; TMEM39B-005; intron 5
OTTHUMT00000091378 ; TMEM39B-006; intron 5
OTTHUMT00000091376 ; TMEM39B-004; intron 6
OTTHUMT00000091380 ; TMEM39B-008; intron 6
OTTHUMT00000091376 ; TMEM39B-004; intron 6
OTTHUMT00000091380 ; TMEM39B-008; intron 6
OTTHUMT00000091376 ; TMEM39B-004; intron 6
OTTHUMT00000091380 ; TMEM39B-008; intron 6
ENST00000441402 ; TMEM39B-003; intron 3
ENST00000498613 ; TMEM39B-007; intron 3
ENST00000373634 ; TMEM39B-202; intron 3
ENST00000441402 ; TMEM39B-003; intron 3
ENST00000498613 ; TMEM39B-007; intron 3
ENST00000373634 ; TMEM39B-202; intron 3
ENST00000441402 ; TMEM39B-003; intron 3
ENST00000498613 ; TMEM39B-007; intron 3
ENST00000373634 ; TMEM39B-201; intron 3
ENST00000438825 ; TMEM39B-009; intron 4
ENST00000456834 ; TMEM39B-204; intron 4
ENST00000373633 ; TMEM39B-201; intron 4
ENST00000438825 ; TMEM39B-009; intron 4
ENST00000456834 ; TMEM39B-204; intron 4
ENST00000373633 ; TMEM39B-201; intron 4
ENST00000438825 ; TMEM39B-009; intron 4
ENST00000456834 ; TMEM39B-203; intron 4
ENST00000487305 ; TMEM39B-002; intron 5
ENST00000336294 ; TMEM39B-001; intron 5
ENST00000472503 ; TMEM39B-006; intron 5
ENST00000466321 ; TMEM39B-005; intron 5
ENST00000487305 ; TMEM39B-002; intron 5
ENST00000336294 ; TMEM39B-001; intron 5
ENST00000472503 ; TMEM39B-006; intron 5
ENST00000466321 ; TMEM39B-005; intron 5
ENST00000487305 ; TMEM39B-002; intron 5
ENST00000336294 ; TMEM39B-001; intron 5
ENST00000472503 ; TMEM39B-006; intron 5
ENST00000466321 ; TMEM39B-005; intron 5
ENST00000468135 ; TMEM39B-004; intron 6
ENST00000476968 ; TMEM39B-008; intron 6
ENST00000427288 ; TMEM39B-203; intron 6
ENST00000468135 ; TMEM39B-004; intron 6
ENST00000476968 ; TMEM39B-008; intron 6
ENST00000427288 ; TMEM39B-203; intron 6
ENST00000468135 ; TMEM39B-004; intron 6
ENST00000476968 ; TMEM39B-008; intron 6
ENST00000427288 ; TMEM39B-202; intron 6

Mature sequence hsa-miR-5585-5p

Accession MIMAT0022285
Sequence

1 -  

ugaaguaccagcuacucgagag

 - 22

Get sequence
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5585-3p

Accession MIMAT0022286
Sequence

38 -  

cugaauagcugggacuacaggu

 - 59

Get sequence
Deep sequencing 25 reads, 8 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).