Stem-loop sequence hsa-mir-5582

Accession MI0019138
Description Homo sapiens miR-5582 stem-loop
Stem-loop 
--                 a     acauc   u 
  uaggcacacuuaaaguu uagcu     agu a
  ||||||||||||||||| |||||     |||  
  auccgugugaauuucaa auuga     uca u
gg                 a     cuaua   a
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr11: 46774675-46774742 [-]
sense
OTTHUMT00000390681 ; CKAP5-004; intron 12
OTTHUMT00000390681 ; CKAP5-004; intron 12
OTTHUMT00000390681 ; CKAP5-004; intron 12
OTTHUMT00000390680 ; CKAP5-003; intron 35
OTTHUMT00000390680 ; CKAP5-003; intron 35
OTTHUMT00000390680 ; CKAP5-003; intron 35
OTTHUMT00000390679 ; CKAP5-002; intron 37
OTTHUMT00000390679 ; CKAP5-002; intron 37
OTTHUMT00000390679 ; CKAP5-002; intron 37
ENST00000533413 ; CKAP5-004; intron 12
ENST00000533413 ; CKAP5-004; intron 12
ENST00000533413 ; CKAP5-004; intron 12
ENST00000354558 ; CKAP5-003; intron 35
ENST00000354558 ; CKAP5-003; intron 35
ENST00000354558 ; CKAP5-003; intron 35
ENST00000312055 ; CKAP5-201; intron 36
ENST00000312055 ; CKAP5-201; intron 36
ENST00000312055 ; CKAP5-201; intron 36
ENST00000529230 ; CKAP5-002; intron 37
ENST00000415402 ; CKAP5-203; intron 37
ENST00000529230 ; CKAP5-002; intron 37
ENST00000415402 ; CKAP5-203; intron 37
ENST00000529230 ; CKAP5-002; intron 37
ENST00000415402 ; CKAP5-202; intron 37
ENST00000378629 ; CKAP5-202; intron 38
ENST00000378629 ; CKAP5-202; intron 38

Mature sequence hsa-miR-5582-5p

Accession MIMAT0022279
Sequence

1 -  

uaggcacacuuaaaguuauagc

 - 22

Get sequence
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5582-3p

Accession MIMAT0022280
Sequence

47 -  

uaaaacuuuaagugugccuagg

 - 68

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).