Stem-loop sequence hsa-mir-548at

Accession MI0019137
Description Homo sapiens miR-548at stem-loop
Gene family MIPF0000317; mir-548
Stem-loop 
--                      gccaa 
  aaaaguuauugcgguuuuggcu     a
  ||||||||||||||||||||||      
  uuuucaaugacgccaaaaccgg     a
ug                      uaaag
Get sequence
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr17: 40646791-40646848 [+]
sense
ENST00000544137 ; ATP6V0A1-205; intron 5
ENST00000544137 ; ATP6V0A1-205; intron 5
ENST00000544137 ; ATP6V0A1-205; intron 5
ENST00000537728 ; ATP6V0A1-204; intron 11
ENST00000537728 ; ATP6V0A1-204; intron 11
ENST00000537728 ; ATP6V0A1-204; intron 11
ENST00000343619 ; ATP6V0A1-202; intron 12
ENST00000546249 ; ATP6V0A1-206; intron 12
ENST00000393829 ; ATP6V0A1-203; intron 12
ENST00000264649 ; ATP6V0A1-201; intron 12
ENST00000264649 ; ATP6V0A1-201; intron 12
ENST00000343619 ; ATP6V0A1-202; intron 12
ENST00000546249 ; ATP6V0A1-206; intron 12
ENST00000393829 ; ATP6V0A1-203; intron 12
ENST00000264649 ; ATP6V0A1-201; intron 12
ENST00000343619 ; ATP6V0A1-202; intron 12
ENST00000546249 ; ATP6V0A1-206; intron 12
ENST00000393829 ; ATP6V0A1-203; intron 12

Mature sequence hsa-miR-548at-5p

Accession MIMAT0022277
Sequence

1 -  

aaaaguuauugcgguuuuggcu

 - 22

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

Mature sequence hsa-miR-548at-3p

Accession MIMAT0022278
Sequence

38 -  

caaaaccgcaguaacuuuugu

 - 58

Get sequence
Evidence experimental; Solexa [2]
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
2
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).