Stem-loop sequence hsa-mir-5581

Accession MI0019136
Description Homo sapiens miR-5581 stem-loop
Stem-loop 
-agc    c     aa        ccuau 
    cuuc aggag  auggagac     a
    |||| |||||  ||||||||     c
    gaag uccuc  uaccuuug     a
ccuu    a     cg        uccau
Get sequence
Deep sequencing
1 reads, 1 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr1: 37966536-37966595 [-]
sense
OTTHUMT00000012163 ; MEAF6-003; intron 4
OTTHUMT00000012163 ; MEAF6-003; intron 4
OTTHUMT00000012163 ; MEAF6-003; intron 4
OTTHUMT00000012162 ; MEAF6-002; intron 5
OTTHUMT00000012161 ; MEAF6-001; intron 5
OTTHUMT00000012164 ; MEAF6-004; intron 5
OTTHUMT00000012165 ; MEAF6-005; intron 5
OTTHUMT00000091269 ; MEAF6-008; intron 5
OTTHUMT00000012167 ; MEAF6-007; intron 5
OTTHUMT00000012162 ; MEAF6-002; intron 5
OTTHUMT00000012161 ; MEAF6-001; intron 5
OTTHUMT00000012164 ; MEAF6-004; intron 5
OTTHUMT00000012165 ; MEAF6-005; intron 5
OTTHUMT00000091269 ; MEAF6-008; intron 5
OTTHUMT00000012167 ; MEAF6-007; intron 5
OTTHUMT00000012162 ; MEAF6-002; intron 5
OTTHUMT00000012161 ; MEAF6-001; intron 5
OTTHUMT00000012164 ; MEAF6-004; intron 5
OTTHUMT00000012165 ; MEAF6-005; intron 5
OTTHUMT00000091269 ; MEAF6-008; intron 5
OTTHUMT00000012167 ; MEAF6-007; intron 5
ENST00000373074 ; MEAF6-003; intron 4
ENST00000373074 ; MEAF6-003; intron 4
ENST00000373074 ; MEAF6-003; intron 4
ENST00000373075 ; MEAF6-002; intron 5
ENST00000296214 ; MEAF6-001; intron 5
ENST00000475828 ; MEAF6-004; intron 5
ENST00000487788 ; MEAF6-005; intron 5
ENST00000373073 ; MEAF6-008; intron 5
ENST00000487792 ; MEAF6-007; intron 5
ENST00000448519 ; MEAF6-201; intron 5
ENST00000373075 ; MEAF6-002; intron 5
ENST00000296214 ; MEAF6-001; intron 5
ENST00000475828 ; MEAF6-004; intron 5
ENST00000487788 ; MEAF6-005; intron 5
ENST00000373073 ; MEAF6-008; intron 5
ENST00000487792 ; MEAF6-007; intron 5
ENST00000448519 ; MEAF6-201; intron 5
ENST00000373075 ; MEAF6-002; intron 5
ENST00000296214 ; MEAF6-001; intron 5
ENST00000475828 ; MEAF6-004; intron 5
ENST00000487788 ; MEAF6-005; intron 5
ENST00000373073 ; MEAF6-008; intron 5
ENST00000487792 ; MEAF6-007; intron 5
ENST00000448519 ; MEAF6-201; intron 5

Mature sequence hsa-miR-5581-5p

Accession MIMAT0022275
Sequence

1 -  

agccuuccaggagaaauggaga

 - 22

Get sequence
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5581-3p

Accession MIMAT0022276
Sequence

39 -  

uuccaugccuccuagaaguucc

 - 60

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).