Stem-loop sequence hsa-mir-664b

AccessionMI0019134 (change log)
Previous IDshsa-mir-644b
Symbol HGNC:MIR664B
DescriptionHomo sapiens miR-664b stem-loop
Gene family MIPF0000300; mir-664
Literature search

30 open access papers mention hsa-mir-664b
(95 sentences)

Stem-loop
   --      aa     au  u         ag 
5'   ugggcu  gggag  ga uggguagaa  u
     ||||||  |||||  || |||||||||  a
3'   auccga  cccuc  uu acuuaucuu  u
   ac      --     cg  u         au 
Get sequence
Deep sequencing
3331 reads, 2.86 reads per million, 140 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 154768596-154768656 [+]
sense
OTTHUMT00000058814 ; RP11-954J6.3-001; intron 1
ENST00000452506 ; TMLHE-AS1-001; intron 1
antisense
OTTHUMT00000058820 ; TMLHE-004; intron 1
OTTHUMT00000058817 ; TMLHE-001; intron 2
OTTHUMT00000058818 ; TMLHE-002; intron 2
ENST00000487422 ; TMLHE-004; intron 1
ENST00000334398 ; TMLHE-001; intron 2
ENST00000369439 ; TMLHE-002; intron 2
Database links

Mature sequence hsa-miR-664b-5p

Accession MIMAT0022271
Previous IDshsa-miR-644b-5p
Sequence

1 - 

ugggcuaagggagaugauugggua

 - 24

Get sequence
Deep sequencing2640 reads, 120 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-664b-3p

Accession MIMAT0022272
Previous IDshsa-miR-644b-3p
Sequence

40 - 

uucauuugccucccagccuaca

 - 61

Get sequence
Deep sequencing667 reads, 104 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).