Stem-loop sequence hsa-mir-548aq

Accession

MI0019130

Description

Homo sapiens miR-548aq stem-loop

Gene family

MIPF0000317; mir-548

Stem-loop

--            u            ac 
  gaaaguaauugc guuuuugccauu  u
  |||||||||||| ||||||||||||   
  uuuucauuaacg caaaaacgguga  u
cg            u            cu 

Deep sequencing

3 reads, 3 experiments

Genome context

• Coordinates (GRCh37.p5): chr3: 185485635-185485692 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000157091 ; IGF2BP2-005; intron 1

  OTTHUMT00000157093 ; IGF2BP2-007; intron 1

  OTTHUMT00000157091 ; IGF2BP2-005; intron 1

  OTTHUMT00000157093 ; IGF2BP2-007; intron 1

  OTTHUMT00000157091 ; IGF2BP2-005; intron 1

  OTTHUMT00000157093 ; IGF2BP2-007; intron 1

  OTTHUMT00000157087 ; IGF2BP2-001; intron 2

  OTTHUMT00000157094 ; IGF2BP2-008; intron 2

  OTTHUMT00000157088 ; IGF2BP2-002; intron 2

  OTTHUMT00000157092 ; IGF2BP2-006; intron 2

  OTTHUMT00000157087 ; IGF2BP2-001; intron 2

  OTTHUMT00000157094 ; IGF2BP2-008; intron 2

  OTTHUMT00000157088 ; IGF2BP2-002; intron 2

  OTTHUMT00000157092 ; IGF2BP2-006; intron 2

  OTTHUMT00000157087 ; IGF2BP2-001; intron 2

  OTTHUMT00000157094 ; IGF2BP2-008; intron 2

  OTTHUMT00000157088 ; IGF2BP2-002; intron 2

  OTTHUMT00000157092 ; IGF2BP2-006; intron 2

  ENST00000461957 ; IGF2BP2-005; intron 1

  ENST00000493302 ; IGF2BP2-007; intron 1

  ENST00000421047 ; IGF2BP2-201; intron 1

  ENST00000461957 ; IGF2BP2-005; intron 1

  ENST00000493302 ; IGF2BP2-007; intron 1

  ENST00000421047 ; IGF2BP2-201; intron 1

  ENST00000461957 ; IGF2BP2-005; intron 1

  ENST00000493302 ; IGF2BP2-007; intron 1

  ENST00000421047 ; IGF2BP2-201; intron 1

  ENST00000382199 ; IGF2BP2-001; intron 2

  ENST00000457616 ; IGF2BP2-008; intron 2

  ENST00000346192 ; IGF2BP2-002; intron 2

  ENST00000466476 ; IGF2BP2-006; intron 2

  ENST00000382199 ; IGF2BP2-001; intron 2

  ENST00000457616 ; IGF2BP2-008; intron 2

  ENST00000346192 ; IGF2BP2-002; intron 2

  ENST00000466476 ; IGF2BP2-006; intron 2

  ENST00000382199 ; IGF2BP2-001; intron 2

  ENST00000457616 ; IGF2BP2-008; intron 2

  ENST00000346192 ; IGF2BP2-002; intron 2

  ENST00000466476 ; IGF2BP2-006; intron 2

Mature sequence hsa-miR-548aq-5p

• Accession: MIMAT0022263
• Sequence: 1 - gaaaguaauugcuguuuuugcc - 22
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548aq-5p
  • MIRDB:hsa-miR-548aq-5p
  • TARGETMINER:hsa-miR-548aq-5p

Mature sequence hsa-miR-548aq-3p

• Accession: MIMAT0022264
• Sequence: 37 - caaaaacugcaauuacuuuugc - 58
• Deep sequencing: 3 reads, 3 experiments
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-548aq-3p
  • MIRDB:hsa-miR-548aq-3p
  • TARGETMINER:hsa-miR-548aq-3p

References

1. PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).