Stem-loop sequence zma-MIR444b

AccessionMI0019129 (change log)
DescriptionZea mays miR444b stem-loop
Gene family MIPF0000402; MIR444
Literature search

8 open access papers mention zma-MIR444b
(12 sentences)

Stem-loop
   uga      a                 u               guuu   aac 
5'    cgagcu gaggcagcaacugcaua cuugcaagaaaauug    ucg   c
      |||||| ||||||||||||||||| |||||||||||||||    |||    
3'    guucga cucuguuguugacgugu gaacguucuuuuaau    agc   a
   guc      a                 u               ----   cau 
Get sequence
Deep sequencing
3222 reads, 1.52e+03 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR444 family. The primary unspliced transcript contains two exons split by an intron of 7661 nts [1].

Database links

Mature sequence zma-miR444b

Accession MIMAT0022262
Sequence

80 - 

ugcaguuguugucucaagcuu

 - 100

Get sequence
Deep sequencing3120 reads, 19 experiments
Evidence by similarity; MI0006974
Database links

References

1
PMID:21421552 "SplamiR--prediction of spliced miRNAs in plants" Thieme CJ, Gramzow L, Lobbes D, Theissen G Bioinformatics. 27:1215-1223(2011).