Stem-loop sequence zma-MIR444a

AccessionMI0019128 (change log)
DescriptionZea mays miR444a stem-loop
Gene family MIPF0000402; MIR444
Literature search

9 open access papers mention zma-MIR444a
(16 sentences)

Stem-loop
         a                 c            -a      uu  u 
5' caagcu gaggcagcaacugcaua cuugcaagaaaa  aucggu  ug u
   |||||| ||||||||||||||||| ||||||||||||  ||||||  ||  
3' guucga cucuguuguugacgugu gaacguucuuuu  uagcca  gc g
         a                 u            ag      -u  a 
Get sequence
Deep sequencing
3676 reads, 1.05e+03 reads per million, 145 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR444 family. The primary unspliced transcript contains two exons split by an intron of 3997 nts [1].

Database links

Mature sequence zma-miR444a

Accession MIMAT0022261
Sequence

79 - 

ugcaguuguugucucaagcuu

 - 99

Get sequence
Deep sequencing2800 reads, 17 experiments
Evidence by similarity; MI0006975
Database links

References

1
PMID:21421552 "SplamiR--prediction of spliced miRNAs in plants" Thieme CJ, Gramzow L, Lobbes D, Theissen G Bioinformatics. 27:1215-1223(2011).