Stem-loop sequence hvsa-miR-HSUR2

AccessionMI0019127 (change log)
DescriptionHerpesvirus saimiri strain A11 miR-HSUR2 stem-loop
Stem-loop
   ucu                   -    gu 
5'    gugcucucaaggcuuuaaa cuuu  g
      ||||||||||||||||||| ||||  u
3'    cacgagaguuccgagauuu gaaa  u
   --u                   u    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvsa-miR-HSUR2-5p

Accession MIMAT0022686
Sequence

1 - 

ucugugcucucaaggcuuuaaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hvsa-miR-HSUR2-3p

Accession MIMAT0022687
Sequence

38 - 

uuuuagagccuugagagcacu

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21925386 "A primate herpesvirus uses the integrator complex to generate viral microRNAs" Cazalla D, Xie M, Steitz JA Mol Cell. 43:982-992(2011).