Stem-loop sequence hvsa-miR-HSUR5

AccessionMI0019125 (change log)
DescriptionHerpesvirus saimiri strain A11 miR-HSUR5 stem-loop
Stem-loop
   -ucc              ugau     a 
5'     gcgcucuuacugcu    acuuc a
       ||||||||||||||    ||||| c
3'     cgcgagagugacga    ugaag a
   ucgu              -cau     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hvsa-miR-HSUR5-5p

Accession MIMAT0022682
Sequence

1 - 

uccgcgcucuuacugcuugau

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence hvsa-miR-HSUR5-3p

Accession MIMAT0022683
Sequence

36 - 

uuacagcagugagagcgcugcu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:21925386 "A primate herpesvirus uses the integrator complex to generate viral microRNAs" Cazalla D, Xie M, Steitz JA Mol Cell. 43:982-992(2011).