|
miRBase |
|
Stem-loop sequence hsa-mir-5100 |
|||||
| Accession | MI0019116 | ||||
| Description | Homo sapiens miR-5100 stem-loop | ||||
| Stem-loop |
ccaugagg a --- ----a --- gga g cu g ga
agcuggc gu ggg uggcc ugggggua gc ugg ucugga cua c
||||||| || ||| ||||| |||||||| || ||| |||||| ||| c
ucgacug cg ucc accgg aucuccgu cg acc agacuu ggu a
-------- a ggu aggac uca -gg - cu g ac
|
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
Mature sequence hsa-miR-5100 |
|
| Accession | MIMAT0022259 |
| Sequence |
68 - uucagaucccagcggugccucu - 89 |
| Deep sequencing | 21 reads, 6 experiments |
| Evidence | experimental; SOLiD [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:21895886
"Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome"
Oral Dis. 18:127-131(2012).
|