Stem-loop sequence hsa-mir-3670-2

AccessionMI0019112 (change log)
Symbol HGNC:MIR3670-2
DescriptionHomo sapiens miR-3670-2 stem-loop
Gene family MIPF0001340; mir-3670
Stem-loop
         -cu  u       cuuuug    -    c 
5' ucuaga   gg auagcug      gagc cuca c
   ||||||   || |||||||      |||| |||| u
3' agaucu   cc ugucgac      cucg gagu g
         cuu  -       -----a    a    c 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 16306370-16306434 [+]
antisense
OTTHUMT00000252232 ; ABCC6-001; intron 5
OTTHUMT00000436243 ; ABCC6-003; intron 5
OTTHUMT00000436244 ; ABCC6-002; intron 5
OTTHUMT00000436245 ; ABCC6-007; intron 6
ENST00000205557 ; ABCC6-001; intron 5
ENST00000456970 ; ABCC6-003; intron 5
ENST00000574094 ; ABCC6-002; intron 5
ENST00000577103 ; ABCC6-007; intron 6
Clustered miRNAs
< 10kb from hsa-mir-3670-2
hsa-mir-3179-2chr16: 16300159-16300242 [+]
hsa-mir-3670-2chr16: 16306370-16306434 [+]
hsa-mir-3180-2chr16: 16309879-16309966 [+]
Database links

Mature sequence hsa-miR-3670

Accession MIMAT0018093
Sequence

40 - 

agagcucacagcuguccuucucua

 - 63

Get sequence
Deep sequencing44 reads, 10 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).