Stem-loop sequence sbi-MIR5387b

AccessionMI0019104 (change log)
DescriptionSorghum bicolor miR5387b stem-loop
Gene family MIPF0001305; MIR5387
Literature search

1 open access papers mention sbi-MIR5387b
(1 sentences)

Stem-loop
   --------   ca      u u                  u        acaac  cu 
5'         cgg  cguggc c gaccggugcuaaaggguc cugcccca     ac  g
           |||  |||||| | |||||||||||||||||| ||||||||     ||   
3'         gcc  gcauug g uuggccacgauuuccuag gacggggu     ug  u
   aaauugug   aa      u c                  -        gccga  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sorghum_bicolor_NCBIv3; GCA_000003195.3) Overlapping transcripts
chr6: 55683234-55683342 [+]
intergenic
Database links

Mature sequence sbi-miR5387b

Accession MIMAT0022249
Sequence

6 - 

cguggcucugaccggugcuaaagg

 - 29

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:21907786 "Identification and temporal expression analysis of conserved and novel microRNAs in Sorghum" Zhang L, Zheng Y, Jagadeeswaran G, Li Y, Gowdu K, Sunkar R Genomics. 98:460-468(2011).