Stem-loop sequence mtr-MIR408

AccessionMI0019094 (change log)
DescriptionMedicago truncatula miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

4 open access papers mention mtr-MIR408
(6 sentences)

Stem-loop
   uagu   u      -aca   a       cau    a     ga  aaa   u       ga 
5'     uaa gacagg    aag cagggaa   gcag gcaug  ug   cua cgacagu  a
       ||| ||||||    ||| |||||||   |||| |||||  ||   ||| |||||||  g
3'     auu uugucu    uuc gucccuu   cguc cguac  ac   ggu guuguca  g
   uauu   u      aaua   g       cuc    a     uc  cuc   -       aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr1: 22930123-22930247 [+]
intergenic
Database links

Mature sequence mtr-miR408-5p

Accession MIMAT0022237
Previous IDsmtr-miR408*
Sequence

21 - 

acagggaacaugcagagcaug

 - 41

Get sequence
Evidence experimental; Illumina [1-3]

Mature sequence mtr-miR408-3p

Accession MIMAT0022238
Previous IDsmtr-miR408
Sequence

85 - 

augcacugccucuucccuggc

 - 105

Get sequence
Evidence experimental; Illumina [1-3]

References

1
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
3
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).