Stem-loop sequence mtr-MIR168c

AccessionMI0019093 (change log)
DescriptionMedicago truncatula miR168c stem-loop
Gene family MIPF0000081; MIR168
Literature search

5 open access papers mention mtr-MIR168c
(20 sentences)

Stem-loop
   ----c    uu         ua     c          u     a   cua  u      u      
5'      ucac  cgcggucuc  auucg uuggugcagg cggga cca   ca ccgcug uuucg 
        ||||  |||||||||  ||||| |||||||||| ||||| |||   || |||||| |||| u
3'      agug  gcgccggag  uaagu aacuacguuc gcccu ggu   gu ggcggc aaaga 
   aucua    --         gc     c          c     a   uaa  -      c      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 10278669-10278794 [+]
intergenic
Clustered miRNAs
< 10kb from mtr-MIR168c
mtr-MIR2670cchr5: 10276042-10276263 [+]
mtr-MIR168cchr5: 10278669-10278794 [+]
Database links

Mature sequence mtr-miR168c-5p

Accession MIMAT0022235
Previous IDsmtr-miR168c
Sequence

21 - 

ucgcuuggugcaggucgggaa

 - 41

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence mtr-miR168c-3p

Accession MIMAT0022236
Previous IDsmtr-miR168c*
Sequence

86 - 

cccgccuugcaucaacugaau

 - 106

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).