Stem-loop sequence mtr-MIR5558

AccessionMI0019085 (change log)
DescriptionMedicago truncatula miR5558 stem-loop
Literature search

1 open access papers mention mtr-MIR5558
(2 sentences)

Stem-loop
   u     caua     c               c uau      c 
5'  gaccu    uuuuc aauucuaagucuauc c   gaauuc a
    |||||    ||||| ||||||||||||||| |   ||||||  
3'  cugga    aaaag uuaagauuuagauag g   cuuaag a
   c     aucg     a               a --c      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 19731787-19731872 [+]
intergenic
Database links

Mature sequence mtr-miR5558-5p

Accession MIMAT0022219
Previous IDsmtr-miR5558
Sequence

11 - 

uuuuccaauucuaagucuauc

 - 31

Get sequence
Evidence experimental; Illumina [1-2]

Mature sequence mtr-miR5558-3p

Accession MIMAT0022220
Previous IDsmtr-miR5558*
Sequence

58 - 

uagauuuagaauuagaaaagc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).