Stem-loop sequence mtr-MIR2592bn

AccessionMI0019084 (change log)
DescriptionMedicago truncatula miR2592bn stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bn
(2 sentences)

Stem-loop
   c                             u          uau      c         -  g         a     -          -      a 
5'  ucgagcauuucgcucggcauucauguuuu ccuuugaaaa   uaaauu uuguugggu ug uuuagauga gguau uaagugucaa gaaaug a
    ||||||||||||||||||||||||||||| ||||||||||   |||||| ||||||||| || ||||||||| ||||| |||||||||| |||||| c
3'  aguucguaaagugggcuguaaguacaaaa ggaaacuuuu   auuuaa aacaaucca ac aaaucuacu ccaua guucacgguu cuuuac c
   -                             -          cuu      a         c  g         a     a          g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 8281152-8281345 [+]
intergenic
Database links

Mature sequence mtr-miR2592bn-5p

Accession MIMAT0022217
Previous IDsmtr-miR2592bn*
Sequence

14 - 

cucggcauucauguuuuuccuu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2592bn-3p

Accession MIMAT0022218
Previous IDsmtr-miR2592bn
Sequence

164 - 

ggaaaacaugaaugucgggug

 - 184

Get sequence
Evidence experimental; Illumina [1]

References

1