Stem-loop sequence mtr-MIR2592bm

AccessionMI0019082 (change log)
DescriptionMedicago truncatula miR2592bm stem-loop
Gene family MIPF0000815; MIR2592
Literature search

1 open access papers mention mtr-MIR2592bm
(2 sentences)

Stem-loop
   c                             u            u      c      g   -ga         au    -          ug       
5'  ucaagcauuucgcucggcauucauguuuu ccuuugaaaaga uaaauu uuguua guu   uuuagauga  guau uaagugucaa  aaugaa 
    ||||||||||||||||||||||||||||| |||||||||||| |||||| |||||| |||   |||||||||  |||| ||||||||||  ||||| c
3'  aguucguaaagugggcuguaaguacaaaa ggaaacuuuucu auuuaa aacgau cga   aaaucuacu  uaua guucacgguu  uuauuc 
   -                             -            u      a      g   aca         ac    a          gu       
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr5: 2926606-2926798 [+]
intergenic
Database links

Mature sequence mtr-miR2592bm-5p

Accession MIMAT0022213
Previous IDsmtr-miR2592bm*
Sequence

14 - 

cucggcauucauguuuuuccuu

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR2592bm-3p

Accession MIMAT0022214
Previous IDsmtr-miR2592bm
Sequence

163 - 

ggaaaacaugaaugucgggug

 - 183

Get sequence
Evidence experimental; Illumina [1]

References

1